Site search
 
Products
 
Scientific library
 
MeBase
 
My SibEnzyme
 
Subscription
 
News
 
Info
 
About us
 
Contacts
 


Cleavage Close to the End of DNA Fragments (oligonucleotides)

To test the varying requirements restriction endonucleases have for the number of bases flanking their recognition sequences, series of double-stranded oligonucleotides that contain the restriction endonucleases recognition sites were digested. In the table shown only one strand of full complementary blunt-ends duplex, recognition sites marked as red.
The experiment was performed as follows: each strand of duplex was phosphorylated using T4 Polynucleotide Kinase and gamma-[32P]ATP. 4 10-4 A260 units of 5'[32P]-labeled oligonucleotide and same quantity of complementary non-labeled oligonucleotide was incubated with 1 mcl of restriction endonuclease at optimal for each enzyme conditions (temperature and buffer). Aliquots were taken at 2 hours and 20 hours and analyzed by 20%PAGE (7M urea). Percent cleavage was determined using Packard Cyclon Storage Phosphor System and computer program OptiQuant Version 3.0.
For each duplex was performed two experiments: in case of "Phosphorylated oligonucleotides" labeled oligonucleotide was phosphorylated at the end which is nearest to recognition site; in case of "Non-Phosphorylated oligonucleotides" labeled oligonucleotide was phosphorylated at the end which is remote from recognition site.


Phosphorylated oligonucleotides


Enzyme
Oligonucleotide sequence
Chain Length
Cleavage, %
2 h
20 h
PciI
TACATGTGTTAACAGCGCTA
AGTACATGTGGGCCCAGTACTGCGCAGCGCTAAC
20
34
0
50
0
75
AfeI
TAGCGCTGTTAACACATGTA
GTTAGCGCTGCGCAGTACTGGGCCCACATGTACT
20
34
0
50
0
50
PsiI
CTTATAAGTGCACGGGCCCA
AGTTTATAACTGGGCCCAAC
20
20
25
>90
50
>90
PspOMI
TGGGCCCGTGCACTTATAAG
GTTGGGCCCAGTTATAAACT
20
20
>90
>90
>90
>90
BstAPI
AGCAAATATTGCTCGATATC
ACTGCAGGCCTTGCCATATG
ACTGAAGCAATATTTGCCGATTA
20
20
23
>90
>90
>90
>90
>90
>90


Non-Phosphorylated oligonucleotides


Enzyme
Oligonucleotide sequence
Chain Length
Cleavage, %
2 h
20 h
PciI
TAGCGCTGTTAACACATGTA
GTTAGCGCTGCGCAGTACTGGGCCCACATGTACT
20
34
25
25
25
50
AfeI
TACATGTGTTAACAGCGCTA
AGTACATGTGGGCCCAGTACTGCGCAGCGCTAAC
20
34
0
50
0
50
PsiI
TGGGCCCGTGCACTTATAAG
GTTGGGCCCAGTTATAAACT
20
20
75
>90
75
>90
PspOMI
CTTATAAGTGCACGGGCCCA
AGTTTATAACTGGGCCCAAC
20
20
25
>90
>90
>90
BstAPI
GATATCGAGCAATATTTGCT
CATATGGCAAGGCCTGCAGT
TAATCGGCAAATATTGCTTCAGT
20
20
23
>90
>90
>90
>90
>90
>90
|  Home  |  Products  |  Scientific library  |  MeBase  |  My SibEnzyme  |  Subscription  |  News  |  Info  |  About us  |  Contacts  |  ISO 9001  |